Спутник ДЗЗ. COMS 1. [Редактировать]

Chollian, (Thousand Li View) также известен как Communication, Ocean and Meteorological Satellite 1(COMS-1), Южно корейский спутник управляемый Корейским аэрокосмическим исследовательским институтом, который используется для связи, океанографии и метеорологических наблюдений. COMS-1 был построенн EADS Astrium и базируется на платформе Eurostar-3000S. Он имел массу около 2460 кг, и нес транспондеры в L/S и Ka диапазоне. его единственная солнечная панель генерирует 2500 ватт энергии. 

Дополнительные наименования

#НаименованияПоиск в новостяхПоиск в документах
1Communication, Ocean and Meteorological SatelliteНайтиНайти
4Communication, Oceanography and Meteorology Satellite - 1НайтиНайти

Дополнительная классификация

1Страна оператор(владелец) - Южная Корея
2Тип оператора(владельца) - государственный
3Тип орбиты - ГСО
4Страна производитель - Южная Корея
5Все спутники ДЗЗ

Технические характеристики

1Масса (сухая), кг.1250
2Масса, кг.2460
3Платформа 1xEurostar-3000S
4Полезная нагрузка 1xMI
5Полезная нагрузка 1xGOCI
6Мощность, Вт2500

Характеристики орбиты

1Наклонение, град0.0
2Апогей, км35797.8
3Перигей, км35790.2
4Период, минут1436.1
5САС, год7
6Длинный диаметр эллипса, км42164

Пусковые характеристики

1Код NSSDC2010-032A

Экономические характеристики

#ХарактеристикаДата измеренияЗначение
1Стоимость (программы), млн. долл.296
2Оператор Космическое агентство Южной Кореи
3Оператор Kompsat 3
4Производитель Astrium
5Производитель Astrium

Информация об удачном запуске

1Дата пуска2010-06-26 at 21:41:00 UTC
2Полезная нагрузка 1xCOMS 1
3Полезная нагрузка 1xArabsat 5A
4Ракета-носитель 1xАриан 5 ECA

Найдено 1000 документов по запросу «COMS 1». [Перейти к поиску]

Дата загрузки: 2018-04-17
Скачать документ
Скачать текст
..., different competence genes, namely comK, comS, and dprA, were alone or.... Overexpression of both comK and comS increased the transformation efficiency of... original copies of comK and comS regardless of the presence of... comK from repression, a small protein, ComS, is able to protect ComK... srf operon with the embedded comS gene. ComS binds to the protease... of comK as well as comS (Hahn et al., 1996; Liu... this work, we expressed comK, comS, and dprA alone or in... et al., 2011; Figure 1). The comS gene is located within the...). Phosphorylated ComA induces expression of comS and activates natural competence (Hahn...-1 REG3 trpC2, manPA::ermC, PmtlA -comS pREG3→REG1 REG4 trpC2, manPA... trpC2, manPA::ermC, PmtlA -dprA-comS pREG5→REG1 REG6 trpC2, manPA...-comS REG32 trpC2, manPA::ermC, PmtlA -comK-comS, pJOE7361.1→REG1 pREG12→REG19 comS REG33 trpC2, manPA::ermC, PmtlA -comK-comS... trpC2, manPA::ermC, PmtlA -comK-comS, comK, pREG13→REG19 REG36 trpC2, manPA::ermC, PmtlA -comK-comS, spo0A REG37 trpC2, manPA::ermC, PmtlA -comK-comS, comQXPA pREG10→REG19 REG120 trpC2...::ermC, PmtlA -comK-comS, degU pREG58→REG19 comS pREG13→REG32 pJOE7122→REG19... generation of the PmtlA -comK-comS (or PmtlA -comKS) cassette, the... were used to amplify the comS gene from B. subtilis 168 in... PCR. Both PmtlA -comK and comS DNA fragments were fused in... PmtlA -luc (luciferase) cassette. Both comS and DNA Manipulation Oligonucleotides used... pJOE7331.2 oripUC18 , bla, PmtlA -comK-comS This study pJOE7361.1 oripUC18 , bla, yvcB′ -PmtlA -comK-comS-hisI-hisF ′ This study pKAM041... pREG3 oripUC18 , bla, yvcB′ -PmtlA -comS-hisI-hisF ′ This study pREG4... oripUC18 , bla, yvcB′ -PmtlA -dprA-comS-hisI-hisF′ This study pREG6... using oligonucleotide pair s8003-s8004 (comS) and s8005-s8006 (dprA), respectively, for creating the PmtlA -comS and PmtlA dprA cassettes. Each... pKAM180 to create pREG3 (PmtlA -comS) and pREG4 (PmtlA -dprA). For... the PmtlA -dpAcomS, the amplified comS DNA fragment was cut by... strains carrying competence genes (comK, comS, dprA) expressed by the B. subtilis... and EcoRI (pREG10). For the comS deletion, oligonucleotides s8172–s8249 and... Induction of comK, dprA, and comS Induction of comK by mannitol... factors than ComK. For example, ComS controls degradation of ComK, and... the effect of ComS and DprA on transformation efficiency, comS and dprA...), REG3 (PmtlA -comS), REG4 (PmtlA -dprA), REG5 (PmtlA -dprA-comS), REG7 (PmtlA -comK-dprA), and REG19 (PmtlA -comK-comS) were... experiments. The Importance of Original comS and comK in REG19 So... induction of combined comK and comS (REG19) results in high transformation... the synthesis of ComK and ComS driven by PmtlA can bypass...-inducing factors, original comK and comS were deleted in REG19. For... comK), REG32 (REG19 comS) and REG35 (REG19 comK comS) were constructed. Deletion... and comS (REG35) drastically decreased the transformation rate (Figure 5). Although, comS seemed... important, deletion of the original comS in REG19 reduced the number... (Figure 5). Since, natural expression of comS depends on the ComP-ComA... expression of original comK and comS are necessary for a high transformation... dimer DNA (Figure 3). Induction of comS (REG3) and dprA (REG4) alone... concomitant expression of dprA and comS (REG5) as well as dprA.... Interestingly, REG19 with comK and comS combined in an artificial operon... simultaneous induction of comK and comS resulted in the strongest transformation... ectopic expression of comK and comS can compensate the need of... the promoters of comK and comS in the presence of branched... of original comK (REG33) or comS (REG32) in the REG19 strain... amount of expressed ComK and ComS by PmtlA is insufficient to... this regulation, we also overexpressed comS in addition to comK which... suggests that the expression of comS remained a barrier for the full..., the ectopic expression of comK/comS increased the transformability and rendered... (control) constructing REG32 ( comS), REG33 ( comK), REG35 ( comK comS), REG36 ( spo0A), REG37...(∼P) regulates many genes other than comS (Ogura et al., 2001). Thus... the conclusion that ComK and ComS synthesized via PmtlA compensate dephosphorylated... by induction of comK and comS under control of PmtlA . The..., O. H., and Zuber, P. (1996). Plasmid-amplified comS enhances genetic competence and suppresses...

Дата загрузки: 2018-04-17
Скачать документ
Скачать текст
... comS s7709 GGAGGATTTCGTGCCGG Integration of comS s8003 AAAAACTTAAGCGAAAGCAAGGAGGAGCAGACG TTTGAACCGATCAGGCAAGCA AAAAAGCTAGCTGTACACTACTTCTCCCTCCAGCAG Integration of comS... (comS) s8175 AAAAAGGATCCTTCCGTTTGTGACAGCAGGA Deletion of srfA (comS) s8249 TCACTTCATTTAGAATTCCATATTGTCATACCTCCCCTA Deletion of srfA (comS) s8250 TATGACAATATGGAATTCTAAATGAAGTGATGAAAGGAGG Deletion of srfA (comS... of PmtlA Luc Integration of comS Integration of dprA trpC2 mutation... of comK, comS (PlicB) s8857 GGGGGCTTAAGCAGAAAAAGGATGGAGGCCA Integration of comK, comS (PlicB) s9092... trpC2, ∆manPA::ermC, PlicB-comK-comS pREG37REG1 trpC2, ∆manPA::ermC, PlicB-comK-comS, ∆comK pREG13REG89 oripUC18, bla... oripUC18, bla, yvcB'-PlicB-comK-comS-hisI-hisF' oripUC18, reppUB110, spcR... by expression of comK and comS under the control of PlicB... became competent, when comK and comS were expressed by PlicB. Even...

Дата загрузки: 2017-06-15
Скачать документ
Скачать текст
... necessary. Any combination of NAVs, COMs or RMUs may selected. Manuals... typical system includes NAVs and COMs that comply with ICAO FM... (Diversity transponders and 8.33 kHz COMs) -Dual RMUs (TCAS ready) -Dual... used with either NAVs or COMs) and two 6-foot harnesses. GASKET.... Microphone outputs support 2 COMs, 1 HF. Independent volume control for 2 COMs, 1 HF, 2 ADFs.... Microphone outputs support 2 COMs, 2 HF. Independent volume control for 2 COMs, 2 HF, 2 ADFs... Horizon applications. Microphone outputs support 2 COMS, 2 HFs, 1 AUX, PA. Independent volume... Horizon applications. Microphone outputs support 2 COMS, 2 HFs, 1 AUX, PA. Independent volume.... Microphone outputs support 2 COMs, 2 HF.Independent volume control for 2 COMs, 2 HF, 2 ADFs.... Microphone outputs support 2 COMS. Independent volume control for 2 COMs, 2 NAVs, 2 ADFs, 2 DME.... Microphone outputs support 2 COMs, 1 HF. Independent volume control for 2 COMs, 1 HF, 2 ADFs.../145 applications. Microphone outputs support 3 COMS, 1 HF and 1 PAX. Independent volume... XP applications. Microphone outputs support 2 COMS, 2 HFs, 1 AUX, CABIN Independent volume... XP applications. Microphone outputs support 2 COMS, 2 HFs, 1 AUX, CABIN. Independent volume... S-76 applications. Microphone outputs support 2 COMS, 3 AUX, PAGE. Independent volume control.../145 applications. Microphone outputs support 3 COMS, 1 HF and 1 PAX. Independent volume... S-76 applications. Microphone outputs support 2 COMS, 3 AUX, PAGE. Independent volume control.... Microphone outputs support 2 COMS. Independent volume control for 2 COMs, 2 NAVs, 2 ADFs, 2 DME... SJ30-2 applications. Microphone outputs support 2 COMs, interphone, and PAGE. Independent volume... SJ30-2 applications. Microphone outputs support 2 COMs, interphone, and PAGE. Independent volume... 8.33kHz. Available for wide body COMs only. No wiring change. No.... Available only for wide body COMs that were ACARS compatible before... S-76 applications. Microphone outputs support 2 COMS, 3 AUX, PAGE. Independent volume control... S-76 applications. Microphone outputs support 2 COMS, 3 AUX, PAGE. Independent volume control... XP applications. Microphone outputs support 2 COMS, 2 HFs, 1 AUX, CABIN. Independent volume... XP applications. Microphone outputs support 2 COMS, 2 HFs, 1 AUX, CABIN Independent volume.... Microphone outputs support 2 COMS. Independent volume control for 2 COMs, 2 NAVs, 2 ADFs, 2 DME.... Microphone outputs support 2 COMS. Independent volume control for 2 COMs, 2 NAVs, 2 ADFs, 2 DME.... Microphone outputs support 2 COMs, 1 HF. Independent volume control for 2 COMs, 1 HF, 2 ADFs.... Microphone outputs support 2 COMs, 1 HF. Independent volume control for 2 COMs, 1 HF, 2 ADFs.... Microphone outputs support 2 COMs, 2 HF. Independent volume control for 2 COMs, 2 HF, 2 ADFs.... Microphone outputs support 2 COMs, 2 HF.Independent volume control for 2 COMs, 2 HF, 2 ADFs.../145 applications. Microphone outputs support 3 COMS, 1 HF and 1 PAX. Independent volume.../145 applications. Microphone outputs support 3 COMS, 1 HF and 1 PAX. Independent volume... SJ30-2 applications. Microphone outputs support 2 COMs, interphone, and PAGE. Independent volume... SJ30-2 applications. Microphone outputs support 2 COMs, interphone, and PAGE. Independent volume... Horizon applications. Microphone outputs support 2 COMS, 2 HFs, 1 AUX, PA. Independent volume... Horizon applications. Microphone outputs support 2 COMS, 2 HFs, 1 AUX, PA. Independent volume... audio panel. Microphone outputs support 3 COMS, 1 HF, 1 AUX, 1 PAX. Independent volume... audio panel. Microphone outputs support 3 COMS, 1 HF, 1 AUX, 1 PAX. Independent volume... outputs support 2 COMs, 1 HF, 2 AUX. Independent volume control for 2 COMs, 1 HF, 2 ADFs... outputs support 2 COMs, 1 HF, 2 AUX. Independent volume control for 2 COMs, 1 HF, 2 ADFs.... Available only for wide body COMs that were ACARS compatible before... 8.33kHz. Available for wide body COMs only. No wiring change. No... used with either NAVs or COMs) and two 6-foot harnesses. IK...

Дата загрузки: 2017-06-15
Скачать документ
Скачать текст
... Diagram SEG0 SEG131 COM0 COM63 COMS VDD, VDD3 V0 V1 V2... slave. 120,285 2006/7/18 COMS 11 Ver 1.0 With respect to... COM59 COM60 COM61 COM62 COM63 COMS 83 82 00 83 SEG0... COM[0-63] Reverse COM[63-0] COMS COMS COMS COMS The combination of the display...], COMS 0 1 0 32h 1/33 duty Line [0:31], COMS 0 1 1 33h 1/49 duty Line [0:47], COMS 1 0 0 34h 1/65 duty Line [0:63], COMS... Bumper Face Down COM31 COM63 COMS 2. Type II (ADC Select = 1, COM... Select = 0) IC Bumper Face Down COMS COM63 COM45 COM44 CC C OO... O MM M 33 4 3 3 2 COM44 COM45 COM63 COMS S E G 1 3 1 S E G 1 3 0 S E G 1 2 9 S E G 1 2 8 S E G 1 2 7 S E G 1 2 6 S E G 1 2 5 S E G 1 2 4 S S E E G G 1 1 2 2 2 1 S E G 1 2 3 S E G 4 S E G 3 S E G 2 S E G 1 CC OO MM S0 C O M 1 0 COM11... M MM 1 0S 0 2006/7/18 S E G 0 S E G 1 S E G 2 S E G 3 S E G 4 S E G 5 S E G 6 S E G 7 S E G 8 S E G 1 2 7 S E G 9 58 S E G 1 2 8 S E G 1 2 9 S E G 1 3 0 S E G 1 3 1 COMS COM63 COM45 COM44 C CC O OO... = 1: Internal Rb/Ra) COM44 COM63 COMS COM43 COM42 FR CL /DOF... SEG3 SEG2 SEG1 VR SEG0 M/S COMS CLS COM0 C86 COM1 P/S COM2... = 1: Internal Rb/Ra) COM44 COM63 COMS COM43 COM42 FR CL /DOF... SEG3 SEG2 SEG1 VR SEG0 M/S COMS CLS COM0 C86 COM1 P/S COM2... = 1: Internal Rb/Ra) COM44 COM63 COMS COM43 COM42 FR CL /DOF... SEG3 SEG2 SEG1 VR SEG0 M/S COMS CLS COM0 C86 COM1 P/S COM2... COM43 265 264 NT7538 285 COMS 1 87 Pad No. Designation X Y Pad... 2430.00 -340.00 120 COMS 2261.00 320.00 85... 285 COM60 COM61 COM62 COM63 COMS -2790.00 -2790.00 -2790... COM43 265 20 30 30 COMS 1 87 Pad Dimensions Item Size...

Дата загрузки: 2017-06-15
Скачать документ
Скачать текст
... necessary. Any combination of NAVs, COMs or RMU's may be selected... typical system includes NAVs and COMs that comply with ICAO FM... (Diversity transponders and 8.33 kHz COMs) -Dual RMUs (TCAS ready) -Dual... used with either NAVs or COMs) and two 6-foot harnesses. IK.... Microphone outputs support 2 COMs, 1 HF. Independent volume control for 2 COMs, 1 HF, 2 ADFs.... Microphone outputs support 2 COMs, 2 HF. Independent volume control for 2 COMs, 2 HF, 2 ADFs... Horizon applications. Microphone outputs support 2 COMS, 2 HFs, 1 AUX, PA. Independent volume... Horizon applications. Microphone outputs support 2 COMS, 2 HFs, 1 AUX, PA. Independent volume.... Microphone outputs support 2 COMs, 1 HF. Independent volume control for 2 COMs, 1 HF, 2 ADFs.../145 applications. Microphone outputs support 3 COMS, 1 HF and 1 PAX. Independent volume.... Microphone outputs support 2 COMS. Independent volume control for 2 COMs, 2 NAVs, 2 ADFs, 2 DME... S-76 applications. Microphone outputs support 2 COMS, 3 AUX, PAGE. Independent volume control.... Microphone outputs support 2 COMs, 2 HF.Independent volume control for 2 COMs, 2 HF, 2 ADFs... XP applications. Microphone outputs support 2 COMS, 2 HFs, 1 AUX, CABIN Independent volume... XP applications. Microphone outputs support 2 COMS, 2 HFs, 1 AUX, CABIN. Independent volume... S-76 applications. Microphone outputs support 2 COMS, 3 AUX, PAGE. Independent volume control.../145 applications. Microphone outputs support 3 COMS, 1 HF and 1 PAX. Independent volume.... Microphone outputs support 2 COMS. Independent volume control for 2 COMs, 2 NAVs, 2 ADFs, 2 DME... SJ30-2 applications. Microphone outputs support 2 COMs, interphone, and PAGE. Independent volume... SJ30-2 applications. Microphone outputs support 2 COMs, interphone, and PAGE. Independent volume... 8.33kHz. Available for wide body COMs only. No wiring change. No.... Available only for wide body COMs that were ACARS compatible before... S-76 applications. Microphone outputs support 2 COMS, 3 AUX, PAGE. Independent volume control... S-76 applications. Microphone outputs support 2 COMS, 3 AUX, PAGE. Independent volume control... XP applications. Microphone outputs support 2 COMS, 2 HFs, 1 AUX, CABIN. Independent volume... XP applications. Microphone outputs support 2 COMS, 2 HFs, 1 AUX, CABIN Independent volume.... Microphone outputs support 2 COMS. Independent volume control for 2 COMs, 2 NAVs, 2 ADFs, 2 DME.... Microphone outputs support 2 COMS. Independent volume control for 2 COMs, 2 NAVs, 2 ADFs, 2 DME.... Microphone outputs support 2 COMs, 1 HF. Independent volume control for 2 COMs, 1 HF, 2 ADFs.... Microphone outputs support 2 COMs, 1 HF. Independent volume control for 2 COMs, 1 HF, 2 ADFs.... Microphone outputs support 2 COMs, 2 HF. Independent volume control for 2 COMs, 2 HF, 2 ADFs.... Microphone outputs support 2 COMs, 2 HF.Independent volume control for 2 COMs, 2 HF, 2 ADFs.../145 applications. Microphone outputs support 3 COMS, 1 HF and 1 PAX. Independent volume.../145 applications. Microphone outputs support 3 COMS, 1 HF and 1 PAX. Independent volume... SJ30-2 applications. Microphone outputs support 2 COMs, interphone, and PAGE. Independent volume... SJ30-2 applications. Microphone outputs support 2 COMs, interphone, and PAGE. Independent volume... Horizon applications. Microphone outputs support 2 COMS, 2 HFs, 1 AUX, PA. Independent volume... Horizon applications. Microphone outputs support 2 COMS, 2 HFs, 1 AUX, PA. Independent volume.... Available only for wide body COMs that were ACARS compatible before... 8.33kHz. Available for wide body COMs only. No wiring change. No... used with either NAVs or COMs) and two 6-foot harnesses. IK...

Дата загрузки: 2017-06-15
Скачать документ
Скачать текст
... the Communication, Ocean, Meteorological Satellite-1 (COMS-1) Geostationary Orbit Satellite (GEO), and... the Communication, Ocean, Meteorological Satellite-1 (COMS-1) satellite which has a well-known... the light variation of the COMS-1 Geostationary Orbit Satellite (GEO) satellite... al. Photometric Brightness Variation Table 1. COMS 1 observation log. Specification Object Obs... Telescope (cm) CCD camera Values COMS-1 23. Feb 8.3 30 303 61..., the minimum phase angle of COMS-1 shows 15.72˚ at 2455616... ). Fig. 2. The light curve of COMS-1 satellite. 3. PHOTOMETRIC OBSERVATION To verify... differential brightness change of the COMS satellite. In this observation, we... aperture photometry. Fig. 2 shows the COMS-1 light curve made from observation.... Fig. 3 is one of our COMS-1 observation image frames. The observed... our observation. The time Fig. 3. COMS 1 image on Feb. 23th, 2011... Observatory. The left dot is COMS 1, and right dot is JCSAT... analysis For the estimation of COMS-1 brightness variation, we used a rendering... the Sun’s direction. The Fig. 4. COMS-1 rendering model to estimate reflectance... model. From this result, the COMS-1 satellite shows that the brightness...'s equation and observational data of COMS-1. 183 http://janss.kr J. Astron...,000 km, the altitude of COMS 1. Maximum brightness of the modeling... simulation. In the case of COMS-1, the light curve shows a single... solar phase angle of the COMS-1 was computed by http://dx...

Дата загрузки: 2017-09-24
Скачать документ
Скачать текст
... of COMS 2. Improvement in COMS data 3. Plan for Geo-KOMPSAT-2A COMS Program COMS... Imager GOCI Observation Modes of COMS LA ENH ENHevery every15 15min... timesan anhour hour COMS Data Services Service via COMS(HRIT/LRIT) - Asia.... • Service via Internet - NMSC provides COMS Level 1B data of all... Foreign Satellite Data COMS (MI) MTSAT HIMAWARI-8 NPP COMS(GOCI) DMSP(SSM... receiving and analysis system of COMS  Targets : Sri Lanka (`10~`12... course, 2016~2018, NMSC, Korea 9 COMS Data Products  16 Baseline Products... Humidity) (Cloud Top Temperature/Height) COMS CA CSR (Cloud Analysis) (Clear... (Outgoing Longwave Radiation) (Rainfall Intensity) COMS Composite Images Disaster Mitigation Short... Monitoring Ocean Meteorology Agriculture Hydrology COMS product validation and improvement Algorithm improvement through the COMS data quality monitoring in real... truth data Collocation Quality monitoring COMS Improving algorithm Map, Day, Month... Status of COMS Cloud Detection Algorithm • The operational COMS CLD algorithm shows... Cover Operational Cloud Cover from COMS vs visual observation at Seoul... 1500 1000 500 0 -10 -9 -8 -7 -6 -5 -4 -3 -2 -1 0 1 2 3 4 5 6 7 8 9 10 COMS - Visual Improved Cloud Cover through...) Sea Surface Temperature Composite  Operational COMS SST COMS MI R = 0.98 BIAS = -0.52.../NMSC SST Composite Operational Monthly COMS SST compared with buoy at... of techniques for supporting NWP     COMS products quality management(AMV, sea... 1% accuracy improvement of NWP through COMS AMV assimilation 25 NWP Support... Humidity ○ ○ ○ Satwind Wind(p) (AMV) GEO 6(COMS) LEO 2 ○ ○ Satwind METOP-A/B Sea Surface... GPS_RO METOP-A/B COSMIC Temperature ○ ○ ○ ○ CSR COMS Humidity AMSU-A/B, MHS, HIRS (Scatterometer... & icing area analysis based on COMS data Aviation meteorological information to... storm, Volcanic Ash * Flight Icing COMS Icing (19:45 UTC 2 Sep. 2013) * Turbulence COMS IR(17:45 UTC 18... bands Geo-KOMPSAT-2A AMI COMS MI Channel Band name wavelength... monitoring tech. COMS MI vs. GEO-KOMPSAT-2A AMI COMS Geo-KOMPSAT-2A 1 channel (achromatic) 4 channels (color) COMS Geo... • Maintain L/HRIT broadcast corresponding to COMS five channels - Develop the functions to generate COMS-like L/HRIT image data from... receiving GK-2A L/HRIT for COMS S/MDUS • GOCI-II on GK... GK-2A (TBD) Data Rate COMS -> GK-2A Ultra HRIT HRIT... line(website) • Currently, NMSC provides COMS level 1B data of all...

Дата загрузки: 2017-10-24
Скачать документ
Скачать текст
... Communication, Ocean, and Meteorological Satellite (COMS) is currently in the early... chapter gives a comprehensive overview of COMS in terms of its key... remote sensing community. 2. COMS: Description and overview COMS is a multi-purpose, multi... & Telecommunications Research Institute (ETRI). 2.1 COMS overview COMS is a single geostationary satellite fulfilling... been newly developed for the COMS mission. The spacecraft launch mass..., along with the COMS flight model during AIT. Fig. 1. COMS, in stowed... subsections give a succinct description of COMS system, in terms of its... ground segment. www.intechopen.com COMS, the New Eyes in the... Sensing 237 2.2 Description of COMS system The COMS system consists of the... relay. Fig. 2. COMS system overview 2.2.1 COMS spacecraft bus The COMS spacecraft bus is... east and west walls. The COMS spacecraft is 3-axis stabilized. Attitude... engine. The key feature of COMS AOCS (Attitude and Orbit Control... 2.5 KW. Fig. 3. Block diagram of COMS spacecraft functional architecture The heart... from the GOES imager for COMS program. No. Channel Wavelength(μm) IFOV... power system with redundancy. Fig. 4. COMS MI sensor module, in design... Communication, Ocean, and Meteorological Satellite (COMS) of Korea. GOCI mission overview.... GOCI imaging principle 2.2.4 COMS INR system Overview of COMS INR system Achieving... practically successful. In COMS INR, www.intechopen.com 245 COMS, the New... shows the overall architecture of COMS INR. All the processing are... Fig. 11. COMS INR overall architecture Description of COMS INR system and... processing which comprises the whole COMS INR system, as shown in..., time, cloud conditions. 2.2.5 COMS ground segment The COMS GS (Ground Segment) consists... (Flight Dynamics Subsystem), and CSS (COMS Simulator Subsystem) (Lee et al... shows the essential architecture of COMS ground segment with key composing... 3 describes functions of subsystem for COMS ground segment; DATS, IMPS, LHGS..., and CSS (SGCS). Fig. 12. COMS ground segment architecture with key... of the COMS ground segment 3. COMS in-orbit performances 3.1 COMS AOCS performances and... the platform stability. Fig. 13. COMS platform stability, as measured for... Visible dark noise analysis results, COMS MI in-orbit SNR at... MI in-orbit radiometric calibration COMS IOT (In-Orbit Test) MI... greatly removed. www.intechopen.com COMS, the New Eyes in the... MI data processing system of COMS (called IMPS) indicated that relative... the visible one. The complete COMS MI images resulted from the... www.intechopen.com (b) SD Stability COMS, the New Eyes in the... 8 illustrate the typical performances of COMS INR as observed during the IOT. Table 8. COMS MI and GOCI INR performances... is the fact that the COMS AOCS pointing performaces, as described... illustrate some of these typical COMS INR performances. Mode: ENH, Channel... of the normal operation of COMS for the distribution and service... suggestions. www.intechopen.com 259 COMS, the New Eyes in the... mentioned in the previous sections, COMS MI Level 1B data are...(level 2) are produced by CMDPS (COMS Meteorological Data Processing System) as.... 25. COMS Meteorological Products Parts of meteorological products from COMS MI have... since April 1, 2011 together with COMS operation. Those products are cloud..., rain (a) (b) (c) Fig. 26. Examples of COMS meteorological products (a) cloud phase (b) atmospheric... and May was compared with COMS GOCI and MODIS (Moderate Resolution... West Sea or originated locally. COMS can monitor and watch the... Very Short Range Forecasting utilizing COMS MI meteorological data, which was... Satellites). (a) (b) Fig. 27. Examples of COMS MI data applications (a) Convective rain... development www.intechopen.com 261 COMS, the New Eyes in the... turbulence. (a) (b) Fig. 28. Examples of COMS MI aeoronautical meteorological products (under... Fishing ground environmental information 263 COMS, the New Eyes in the... Geostationary Remote Sensing 267 5. Conclusion COMS is a unique bird in many... could be cautiously said that COMS image data and the processed... all the aspects of the COMS development and operation; from the... geostationary remote sensing satellites. 6. Acknowledgment COMS program has involved so many... a very small portion of all COMS family members, and we believe... least, we remember our missing COMS family members, Mr. Daniel Buvat... earth in the course of COMS development and operation, leaving the... devastation. Along the lines of COMS history, with the trace of... contribution to the success of COMS, they will always be remembered...) Kim, H.; Meyer, P.; Crombez, V.; Harris, J. (2010) COMS INR: Prospect and Retrospect, 61st... into the Success of the COMS Mission, 62nd International Astronautical Congress... Aerospace Research Institute) (January 2006). COMS Ground Segment Specification, Ref C1.... (April 2006). Funtional Design of COMS Satellite Ground Control System, Conference... Test Operational Validation of the COMS Image Data Acquisition and Control...-sensing-advanced-techniques-and-platforms/coms-the-new-eyes-inthe-sky...

Дата загрузки: 2017-01-23
Скачать документ
Скачать текст
Скачать перевод
Посмотреть билингву
... THE FLIGHT DYNAMICS SYSTEM FOR COMS SATELLITE Byoung-Sun Lee(1), Yoola..., kby@kari.re.kr Keywords: COMS, flight dynamics, station-keeping, orbit...: As a multi-mission GEO satellite, COMS has three payloads including Ka... color imager, and meteorological imager. COMS flight dynamics system provides the... of the major functions in COMS flight dynamics system is presented... month of operations period. Keywords: COMS, flight dynamics, station-keeping, orbit..., Communications, Ocean, and Meteorological Satellite (COMS) was launched in June 26... and two station-acquisition maneuvers, COMS satellite was stationed at 128... July 4, 2010. Since then, the COMS satellite ground control system [1] is... operations, and satellite simulation. The COMS satellite has three payloads including... Meteorological Imager (MI). Although the COMS spacecraft bus is based on... attitude with 5 wheels and 7 thrusters, COMS should perform twice a day Wheel... affect on the satellite orbit [2]. COMS Flight Dynamics System (FDS) provides... methodology was applied to the COMS FDS development [3]. Programming language C# within... used for the implementation of COMS flight dynamics system on Windows... of the major functions in COMS FDS is presented for the... is very important because the COMS FDS is newly developed and firstly applied to COMS satellite operations. The another newly... singularity in longitudinal separation between COMS satellite and Daejeon station. Weekly... year oscillator were calculated in COMS FDS. The updated oscillator parameters... the geometrical singularity between the COMS satellite longitude of 128.2° and... bias estimation by orbit determination COMS OD uses high fidelity dynamic...) is used to adjust COMS orbit every day. COMS satellite position, velocity... respectively in order to maintain COMS within 128.2°±0.05° longitude and... side effect caused by NSSK [7]. COMS FDS provides three kinds of... updated after fuel accounting. Figure 5. COMS station keeping window Maneuver Table...-burn :3 MFT 3.2 Wheel Off-Loading COMS satellite has single solar panel... generated by single solar panel, COMS should perform twice-a-day WOL... in fuel accounting function of COMS FDS. The actual thruster operations...-Vs are based on the COMS spacecraft design. There are some... 3.3 Fuel Accounting Remaining fuel of COMS has been estimated using two... for each used thrusters in COMS satellite were counted to estimate... the orbital speed of the COMS satellite. Figure 7 presents remaining fuel... shown in Figure 8. Table 8 shows COMS satellite mass changes during six... and oxidizer are used. Figure 6. COMS fuel accounting report Figure 7. Remaining...:00:00 Consumed mass Table 8. COMS total mass Dry mass Fuel... in oscillator updating stack in COMS FDS. Table 9 presents updated sidereal... Sensors (IRES) on board the COMS satellite due the Sun and... Earth disk shown in COMS orbital position. The COMS FDS provides the... the Earth 5. Conclusions A newly developed COMS Flight Dynamics System (FDS) has... operated with performance factors. The COMS satellite will be in normal... the functions in COMS FDS. In the mean time, COMS FDS will..., J.-H., and Kim, J., “Design of the COMS satellite ground control system”, Journal... wheel off-loading strategy of COMS”, Proceedings of the 24th AIAA... the flight dynamics system for COMS satellite mission operations”, Acta Astronautica... Kim, B.-Y., “Operational Validation of the COMS Satellite Ground Control System During... Station-Keeping maneuver strategy for COMS satellite using iterative process”, Advances...

Дата загрузки: 2017-01-16
Скачать документ
Скачать текст
Скачать перевод
Посмотреть билингву
... need to complete COMS 6001 and two courses (COMS 6009 and one... months; 2-3 semesters) Candidates register for COMS 6000, 6009 and one elective... 1 COMS 6000 AND COMS 6009 SEMESTER 2 COMS 6002 OR COMS 6003 OR COMS 6004 AND COMS... & EDUCATION YEAR II SEMESTER I COMS 7009 SEMESTER 2 COMS 6002 Communication Project Research... MONTHS; SEMESTERS 3-4) Candidates register for COMS 7009 and 7099 (20 credits... meet departmental requirements SEMESTER 2 COMS 7009 COMS 7099 Communication Project Research Methods... MONTHS; 2-3 SEMESTERS) Candidates register for COMS 6001, 6009 and one elective... departmental requirements YEAR I SEMESTER 1 COMS 6001 AND COMS 6009 Topics in Language.../PhD only) OR COMS 6003 OR COMS 6004 AND COMS 6009 Health Communication... Research Methods Seminar 3 (MPhil/PhD) COMS 8009 MPhil Communication Thesis (Written... April) SEMESTER 2 COMS 8009 YEAR IV SEMESTER 1 COMS 8009 SEMESTER 2 COMS 8009 Communication... 3 core courses, including COMS 6001 (12 credits) and COMS 6009 (8 credits), and... months; 2-3 semesters) Candidates register for COMS 6001, 6009, one elective (26... departmental requirements. YEAR I SEMESTER 1 AND 2 COMS 6001 Human Communication Topics - 12... Topics (MPhil, PhD only) AND COMS 6009 Communication Research Methods 1 8 credits..., PhD) SEMESTER 2 COMS 6002 OR COMS 6003 OR COMS 6004 AND COMS 6009 PART... Research Methods Seminar 3 (MPhil / PhD) COMS 8099 PhD Communication Dissertation (Written... April) SEMESTER 2 COMS 8099 YEAR IV SEMESTER 1 COMS 8099 SEMESTER 2 COMS 8099 Health... OFFERED 2016/2017) COURSE CODE: COMS 6000 COURSE TITLE: HUMAN COMMUNICATION... OFFERED 2016/2017) COURSE CODE: COMS 6001 COURSE TITLE: TOPICS IN... OFFERED 2016/2017) COURSE CODE: COMS 6002 COURSE TITLE: HEALTH COMMUNICATION... OFFERED 2016/2017) COURSE CODE: COMS 6003 COURSE TITLE: MEDIA, CULTURE... OFFERED 2016/2017) COURSE CODE: COMS 6004 COURSE TITLE: ORGANISATIONAL AND...: I AND II (2 SEMESTERS) COURSE CODE: COMS 6009 COURSE TITLE: COMMUNICATION RESEARCH...: I AND II (2 SEMESTERS) COURSE CODE: COMS 7009 COURSE TITLE: COMMUNICATION PROJECT...: I AND II (2 SEMESTERS) COURSE CODE: COMS 7099 COURSE TITLE: COMMUNICATION PROJECT...: I AND II (2 SEMESTERS) COURSE CODE: COMS 8009 COURSE TITLE: COMMUNICATION THESIS...: I AND II (2 SEMESTERS) COURSE CODE: COMS 8099 COURSE TITLE: COMMUNICATION DISSERTATION...